Print bookPrint book

13.2 Applications and skills

13.2.1 Innovations and techniques in microbiology
13.2.2 Benefits and risks of genetically modified plants
13.2.3 Environmental consequences of biofilms
13.2.4 Technology in medicine (HL)
13.2.5 Using databases (HL)

Site: Philpot Education
Course: Biology Support Site
Book: 13.2 Applications and skills
Printed by: Guest user
Date: Sunday, 27 September 2020, 3:47 PM

13.2.1 Innovations and techniques in microbiology

  • One aspect of the nature of science is that sometimes serendipity leads to scientific discovery.
  • Alexander Fleming was a physician and bacteriologist who discovered penicillin in England in 1928.
  • Early attempts to produce penicillin in shallow trays were unsuccessful. The products were unstable and the cultures were easily contaminated.
  • ‘Deep tank’ batch fermentation made the mass production of penicillin possible. Food chemists had been using a similar technique to produce citric acid, as well as other food additives.
  • The story of penicillin is not only about serendipity, but also of co-operation, innovation and technological advancement.

Skill: Gram staining procedure

  • Antibiotics like penicillin, work by inhibiting the synthesis of peptidoglycan, a major component of bacterial cell walls.
  • The Gram staining procedure is a simple test that differentiates between two types of bacterial cell wall.

Figure 13.2.1a – Structure of Gram+ (left) and Gram– (right) cell walls.Figure 13.2.1a – Structure of Gram+ (left) and Gram (right) cell walls.

Figure 13.2.1b – Outline of Gram staining procedureFigure 13.2.1b – Outline of Gram staining procedure

 

Figure 13.2.1c – Results of the Gram staining procedureFigure 13.2.1c – Results of the Gram staining procedure

  • Bacteria are classed as either Gram+ or Gram- based on the results of this test. 
    • Gram+ bacteria stain purple
    • Gram bacteria stain pink

Skill: Measuring zones of inhibition in bacterial culture

  • To test antimicrobial properties, bacteria may be cultured on agar plates interspersed with small discs of filter paper that have been soaked in various test substances.
  • During incubation, the antimicrobial agent will diffuse out of the disc, so that a concentration gradient is achieved.
  • After one or two days of incubation, the bacterial lawn becomes interrupted by areas with no bacterial growth, called zones of inhibition, that develop around the discs.
  • The dimensions of the zone of inhibition can be measured and compared.
  • If a zone of inhibition is very large, it means that small concentrations of substance are effective at preventing microbial growth.

Figure 13.2.1d – Zones of inhibition develop around antibiotic disksFigure 13.2.1d – Zones of inhibition develop around antibiotic disks

Try it!

  • Which of the antibiotics shown in Figure 13.2.1d is the most effective?
  • Which is the least effective?
  • How could you determine the minimum concentration of antimicrobial agent necessary to inhibit bacterial growth?

Skill: Producing biogas in a small-scale fermenter

  • It is simple to set up a small-scale fermenter, using household materials and manure.
  • Use opaque materials – you do not want to introduce photosynthetic organisms.

Figure 13.2.1e – Small-scale biogas generatorFigure 13.2.1e – Small-scale biogas generator

  • For the first few weeks, it will produce only carbon dioxide, but if kept in a warm place (about 20°C), methanogenic bacteria will eventually reduce all the carbon dioxide into methane gas.

Figure 13.2.1f – Alexander FlemingFigure 13.2.1f – Alexander Fleming
Alexander Fleming with a culture of Staphylococcus , a Gram+ bacterium.

Figure 13.2.1g – E. coliFigure 13.2.1g – E. coli
Escherichia coli is a Gram bacterium.

TOK

To what extent are ‘accidental’ discoveries a product of luck?

Nature of Science

Serendipity and technological innovation: Deep tank fermentation allowed the discovery of penicillin to become the mass-produced wonder drug that saved thousands of soldiers' lives during the Second World War.

In the lab

  • Inoculating slides with bacteria takes practice and skill. Petri dishes are easily contaminated. In the video on top of this column a simple and aseptic method to perform a disc diffusion test is shown.
  • You can soak filter paper discs with household cleaners or ethanol to perform your own Zone of Inhibition tests.

Figure 13.2.1h – HomemadeFigure 13.2.1h – Homemade

  • How will you know when you are producing methane in your biogas reactor? Test the gas in a bunsen burner!

13.2.2 Benefits and risks of genetically modified plants

  • As you learn some applications of genetically modified plants, consider:
    • What is the target protein? How are the target genes added to the plant genome?
    • Which crop species are being modified? What are the associated benefits and risks to the environment in which these crops are grown?

Solanum tuberosum for paper and adhesive products

  • Potato starch has adhesive properties that are useful in many industrial applications, including paint, glue, textiles, and paper.
  • Conventional potatoes (Solanum tuberosum) produce two types of starch in the following proportions: amylose (20%) and amylopectin (80%).
  • Recall from 2.1.3, the biochemistry behind the different structure of starches.

Figure 13.2.2a – Structure of Amlyose/AmylopectinFigure 13.2.2a – Structure of Amlyose/Amylopectin

  • Amylopectin is more fluid and is stable at a greater range of temperatures than amylose – it is the more desirable starch for industrial applications.
  • The AmfloraTM potato has been genetically modified to produce only amylopectin.
  • This was achieved at BASF, by deactivating the gene coding for the production of amylose.

Amflora makes paper and yarn glossier and stronger (Source: BASF)

Tobacco mosaic virus for the production of Hepatitis B vaccine

  • Viruses need a host to reproduce their genetic material. A retrovirus is a type of virus that consists of a strand of RNA surrounded by a protein capsule.
  • Retroviruses infect host cells with RNA and an enzyme, called reverse transcriptase, which is capable of producing DNA from an RNA template. Once the complementary DNA is produced, it becomes incorporated into the host cell’s DNA and the host cell begins to produce proteins from the viral genome.

Figure 13.2.2b – RetrovirusFigure 13.2.2b – Retrovirus
Genetic modification of plants using the TMV vector

  • The tobacco mosaic virus (TMV) is a retrovirus that infects tobacco plants and causes mottling of leaves.

Figure 13.2.2c – TMV infectionFigure 13.2.2c – TMV infection
Normal leaf (left) and infected leaf (middle) leaf; tobacco mosaic virus (right)

  • Current research is focused on the genetic manipulation of TMV to include RNA segments that will code for the production of Hepatitis B antigens.
  • The virus can then be used as a vector to modify tobacco plants for the production of human vaccines.
  • Two strategies are possible: the target proteins may be harvested (biopharming) and purified, or the plants themselves might be administered as edible vaccines.

Use of Ti plasmid for modification of soybean crops

  • Agrobacterium tumefaciens is a naturally-occurring pathogen that transfers part of its own DNA – called the Ti-plasmid – into plant cells, causing tumours in plant tissues.
  • Ti-plasmid is used as a vector in the genetic modification of soybeans, to insert genes for resistance to glyphosphate, a herbicide.

Figure 13.2.2d – Overview of transformation by t-DNA (Ti-plasmid) in crop plants

Skill: Identifying Open Reading Frames

  • Open reading frames are long genetic sequences that are uninterrupted by stop codons. Consider the DNA sequence shown below:

5’   CAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAATCCGAG  3’

3’   GTTACCGATCCATGATACATACTCTAGTACTAGAAATGTTTAGGCTC  5’

Figure 13.2.2e – DNA templateFigure 13.2.2e – DNA template

  • When the top strand is transcribed, the following mRNA sequence results:

5' CUCGGAUUUGUAAAGAUCAUGAUCUCAUACAUAGUACCUAGCCAUUG 3'

  • This mRNA molecule has three reading frames:

Reading frame 1:

CUC GGA UUU GUA AAG AUC AUG AUC UCA UAC AUA GUA CCU AGC CAU UG

Reading frame 2:

C UCG GAU UUG UAA AGA UCA UGA UCU CAU ACA UAG UAC CUA GCC AUU G

Reading frame 3:

CA AUG GCU AGG UAC UAU GUA UGA GAU CAU GAU CUU UAC AAA UCC GAG

  • Recall that AUG is the start codonUAA, UGA and UAG are stop codons.
  • Reading frame 1 contains a start codon (bold), but no stop codons.
  • Reading frame 2 contains stop codons (underlined) but no start codons.
  • Reading frame 3 contains both start and stop codons.
  • Therefore, the only possible ORF is reading frame 1.

Try it!

  • Determine whether there are open reading frames on the bottom strand of the DNA template in Figure 13.2.2e.

Figure 13.2.2f – Ti-plasmidFigure 13.2.2f – Ti-plasmid
Biotech companies take advantage of the Ti-plasmid’s natural ability to infect plant cells with foreign DNA.

Course links

Figure 13.2.2gFigure 13.2.2g

Nature of Science

Assessing risks and benefits of scientific research:

  • What are the advantages and disadvantages of edible vaccines?
  • Do they environmental benefits of herbicide resistant crops, such as decreased tillage and increased yields, outweigh the risk of contamination by herbicide resistant genes?
  • Amflora potatoes have been banned in the European Union. To what extent do political and ethical considerations limit scientific research?

Figure 13.2.2h – Roundup ReadyFigure 13.2.2h – Roundup Ready

Science and social responsibility (Aim 8)

The Monsanto corporation produces a glyphosphate herbicide under the trade name Roundup, and many glyphosphate-resistant crop seeds called Roundup Ready.  To maintain patent rights, farmers are required to repurchase seeds every year rather than save seeds and replant them.

Further reading

Read about a recent Supreme Court cases brought against farmers who deliberately replanted Monsanto patented seeds:

www.biofortified.org

Downloads

Open reading frame activity Word | PDF

13.2.3 Environmental consequences of biofilms

  • Biofilms can form on solid surfaces, but also on the surfaces of fluids, or even suspended in stagnant fluids.
  • How quickly a biofilm develops depends on the species and population density, as well as abiotic factors such as surface porosity, humidity, pH and temperature. 

Using biofilms for sewage treatment

  • Sewage water must be stripped of nutrients in order to prevent eutrophication of ponds and lakes.
  • Eutrophication is an environmental hazard because excess nitrogen and phosphorus cause harmful algal blooms – a rapid accumulation of algae on the surface of water bodies.  

Figure 13.2.3a Biofilms in a trickle filter bedFigure 13.2.3a Biofilms in a trickle filter bed

  • Sewage wastes are irrigated over trickle beds, onto which biofilms of aerobic bacteria develop.
  • The solid layer has a large surface area for biofilm attachment, and the large air spaces between stones allows for good oxygen penetration.
  • Spraying increases aeration. As the wastewater trickles down through the biofilm slime, organic nutrients are removed.
  • The effluent liquid undergoes further treatment before being released.
  • Biofilms are effective at removing nutrients from sewage waste because they cannot easily be washed away.

Problems caused by biofilms

  • Accumulation of biofilms can cause environmental problems including:
    • clogging or corroding of pipes and drains
    • transfer of microorganisms in ballast water
    • contamination of surfaces in food production
    • contamination of hospital equipment and tools

Try it!

  • Suggest a reason for each of the following observations:
    • Contact lens solution contains antibacterial agents as well as surfactants, which are mildly abrasive.
    • Treating bacterial colonies with traditional antibiotics can stimulate biofilm formation.
    • In the presence of Lactococcus lactis (a non-pathogenic bacteria), the rate at which Listeria monocytogenes (a bacteria that causes gastrointestinal infections) forms biofilms is reduced.

Nature of Science: Improvements in apparatus

  • The image below was made using a confocal laser-scanning microscope. The microscope is able to capture images from different depths in a biofilm.
  • Developments in scientific research follow improvements in apparatus: a deeper understanding of the structure of biofilms is now possible because of improvements to apparatus.

Figure 13.2.3b – Laser scan of biofilmFigure 13.2.3b – Laser scan of biofilm
Confocal laser scan of biofilm development on surfaces with varying porosity. (Source: Gouping Feng et al. Bacterial attachment and biofilm formation. Retrieved: www.nature.com/articles/npjbiofilms201522)

Skill: Evaluating evidence for problems caused by biofilms

All of the bacteria shown in Figure 13.2.3b are species that cause infection in humans.

1. Outline the relationship between surface porosity and biofilm depth for all species.

As the porosity of the surface increases, the depth of the biofilm increases. Positive correlation.

2. Predict which species is a common contaminant of food production surfaces.

  • S. epidermis – forms the thickest biofilms of all species, even on the smoothest surface.

or

  • L. monocytogenes – forms thick biofilms on some surfaces and is not part of the normal human flora (whereas S. epidermis / S. aureus are normally found on skin and in nasal cavities).

NB: the command term 'predict' requires a reason. Answers that mention antibiotic-resistance are not appropriate.

Figure 13.2.3c – Ballast waterFigure 13.2.3c – Ballast water
Ballast tanks transfer potentially harmful biofilms around the world

Figure 13.2.3d – Surgical toolsFigure 13.2.3d – Surgical tools

Did you know?

Biofilms of virulent strains of  Staphylococcus that form on medical equipment and tools are responsible for the majority of infections acquired in hospitals.

Figure 13.2.3e – Overview sewageFigure 13.2.3e – Overview sewage
A typical water treatment facility

Figure 13.2.3f – CLIMFigure 13.2.3f – CLIM
The confocal laser scanning microscope has allowed researchers a deeper understanding of the structure of biofilms.

TOK

Emergent properties are the outcome of the interaction of the elements of a system. In what context is a reductionist approach to science productive and in what context is this approach problematic?

13.2.4 Technology in medicine (HL)

Advances in scientific research follow improvements in technology. This is a common theme in the nature of science. Which technologies have been important in this topic?

Innovations such as ELISA and DNA microarray have allowed scientists to diagnose and treat different kinds of disease.

Try it!

  • Make a list of all the diseases that you have learned about in your IB biology course. Classify them as either i) autoimmune, ii) inherited, iii) infectious or iv) degenerative.
  • Do any of the categories overlap? Which of these diseases can be detected and/or treated using the technologies you have learned about in this topic?

Skill: Analysis of a simple microarray

  • We have learned that DNA microarray is used to identify genetic markers of disease.
  • DNA microarray can also be used to identify how disease affects gene expression. All cells from the same species have the same number and type of genes, but disease may cause certain genes to be expressed more (up-regulation) or less (down-regulation) than normal.
  • The microarray below shows the results when the genetic material of two samples (one healthy, one cancerous) is compared.

Figure 13.2.4a – Comparing gene expression in healthy and diseased cellsFigure 13.2.4a – Comparing gene expression in healthy and diseased cells

  • In the experiment, healthy cells were labelled with green fluorescence, and cancerous cells were labelled with red fluorescence.
  • The results may be interpreted as follows:

Observation

Interpretation

No dot

No hybridisation at this locus. This gene is not expressed by either healthy or cancerous cells.

Coloured dot

Locations where cDNA hybridised. Genes are being expressed.

Red dot

More gene expression in cancer cells than in healthy cells at this locus. Cancer may upregulate the expression of these genes.

Green dot

More gene expression in healthy cells than in cancerous cells at this locus. Cancer may down-regulate the expression of these genes.

Yellow dot

Equal gene expression by both samples (red and green light combine to make yellow). Cancer may have no effect on the expression of these genes.

  

Skill: Interpretation of ELISA test

  • There are different types of ELISA. The method you learned in 13.1.4 is called the ‘sandwich ELISA’ and tests for the presence of antigen. It is very effective, but a high degree of skill is required to get clear results.
  • Another type of ELISA, called ‘indirect ELISA’, tests for the presence of antibodies in the blood. This test requires a secondary antibody to bind to the target protein. It also requires that the person has already formed an immune response to the disease. (i.e. early detection is not possible).

Figure 13.2.4b – Indirect ELISA tests for the presence of antibodies in the bloodFigure 13.2.4b – Indirect ELISA tests for the presence of antibodies in the blood

  • Different types of ELISA are more appropriate for different purposes, but in all types of tests a colour-change indicates positive results.

Figure 13.2.4c – Colour change indicates a positive result in ELISAs.Figure 13.2.4c – Colour change indicates a positive result in ELISAs.

  • After a positive result is achieved, the microplate may be placed into a machine that determines the concentration of antigen (or antibody) by measuring the optical density of the samples in each well.
  • If more light is absorbed, (i.e. darker colour), the concentration of antigen (or antibody) is high.

Try it!

  • Outline the steps for a sandwich ELISA for the detection of antigens.
  • Compare ELISA protocols for the detection of antigens, and of antibodies.

Nature of Science

Figure 13.2.4d – Scientific researchFigure 13.2.4d – Scientific research
Developments in scientific research follow improvements in technology – innovation allows for the diagnosis and treatment of disease.

Figure 13.2.4e – Fluorescent cDNAFigure 13.2.4e – Fluorescent cDNA
Fluorescent cDNA lights up when it is hybridised to the DNA on the microarray chip.

Food for thought

What other types of cells could a DNA microarray be used to compare?

Figure 13.2.4f – Microplate readerFigure 13.2.4f – Microplate reader
Concentration of antibody is determined by an absorbance reader.

13.2.5 Using databases (HL)

On this page, you will practise skills from a number of different databases.

Exploring chromosome 21 in Ensembl

Figure 13.2.5a - Chromosome 21, retrieved from: useast.ensembl.orgFigure 13.2.5a - Chromosome 21, retrieved from: useast.ensembl.org

  • Chromosome 21 is the shortest human chromosome – about 48 million base pairs long.
  • Trisomy of chromosome 21 results in Down syndrome.
  • From the ideogram above, it is clear that the long arm (q-arm) of the chromosome has more coding regions than the short arm (p-arm).
  • It follows that there are also more GC repeats (characteristic of telomeres) on the long arm.
  • If you follow the link to the original ideogram, you can click on any region to zoom in and explore genes and sequences.

Using alignment software to compare two proteins

You can use any database to get sequence data on the protein of your choice. For this activity, you will collect sequences from the NCBI database, and then use Clustal Omega software to align the two sequences.

Part A: Find sequences

Go to: www.ncbi.nlm.nih.gov.

Figure 13.2.5b – Step 1Figure 13.2.5b – Step 1

1. From the dropdown menu on the left, choose 'gene', and type in the Search box the name of the protein you are interested in. A list of genes and species will appear. Choose one and click to the ‘full report’ page.

Figure 13.2.5c – Step 2Figure 13.2.5c – Step 2

2. Scroll down until you see ‘genomic regions, transcripts, and products’. Click on FASTA. Copy the entire sequence, including the heading, onto your notepad (plain text format).

Figure 13.2.5d – Step 3Figure 13.2.5d – Step 3

3. Repeat steps 1 and 2 for another protein. You will now have two sequences on your notepad.

Part B: Align sequences

Go to: www.ebi.ac.uk.

Figure 13.2.5e – Clustal OmegaFigure 13.2.5e – Clustal Omega

1. Paste or upload the sequences to be compared into the text box. Click on 'Submit'.

Figure 13.2.5f – ResultsFigure 13.2.5f – Results

The image above shows the results of a nucleotide sequence alignment for the gene coding for the hemoglobin alpha subunit in Homo sapiens (human) and Mus musculus (mouse). Asterisks indicate similarities in the sequence. 

Try it!

Use the NCBI database and Clustal software to compare the sequences in related proteins, such as hemoglobin and myoglobin.

Constructing phylograms and cladograms using DNA sequences

  • Clustal Omega is more appropriately used to align multiple sequences at the same time.
  • The results of a multiple sequence alignment can be displayed as a cladogram (equal branch lengths), or a phylogenetic tree, as shown below.

Figure 13.2.5g – Multiple sequence alignmentFigure 13.2.5g – Multiple sequence alignment
A phylogenetic tree showing evolutionary relationships of hemoglobin genes from ten animal species (generated using Clustal Omega).

Try it!

Collect at least eight different sequences from the NCBI database, perform a multiple sequence alignment, and generate a phylogenetic tree for the protein or gene of your choice.

Figure 13.2.5h – KaryogramFigure 13.2.5h – Karyogram
Chromosome 21 is the smallest human chromosome.

Food for thought

Can you determine the genetic similarity of human and mouse hemoglobin from Figure 13.2.5f?

Figure 13.2.5i – Multiple sequence alignmentFigure 13.2.5i – Multiple sequence alignment
Multiple sequence alignments are easier to interpret when nucleotides are colour-coded.

Figure 15.2.5j – Data miningFigure 15.2.5j – Data mining

TOK

How reliable are knowledge claims justified by reference to data that the researcher did not acquire? How can one be sure of sources and methods developed for different purposes by different researchers? What are the implications for bioinformatics and the future of data mining?

Course links