13.2 Applications and skills

13.2.2 Benefits and risks of genetically modified plants

  • As you learn some applications of genetically modified plants, consider:
    • What is the target protein? How are the target genes added to the plant genome?
    • Which crop species are being modified? What are the associated benefits and risks to the environment in which these crops are grown?

Solanum tuberosum for paper and adhesive products

  • Potato starch has adhesive properties that are useful in many industrial applications, including paint, glue, textiles, and paper.
  • Conventional potatoes (Solanum tuberosum) produce two types of starch in the following proportions: amylose (20%) and amylopectin (80%).
  • Recall from 2.1.3, the biochemistry behind the different structure of starches.

Figure 13.2.2a – Structure of Amlyose/AmylopectinFigure 13.2.2a – Structure of Amlyose/Amylopectin

  • Amylopectin is more fluid and is stable at a greater range of temperatures than amylose – it is the more desirable starch for industrial applications.
  • The AmfloraTM potato has been genetically modified to produce only amylopectin.
  • This was achieved at BASF, by deactivating the gene coding for the production of amylose.

Amflora makes paper and yarn glossier and stronger (Source: BASF)

Tobacco mosaic virus for the production of Hepatitis B vaccine

  • Viruses need a host to reproduce their genetic material. A retrovirus is a type of virus that consists of a strand of RNA surrounded by a protein capsule.
  • Retroviruses infect host cells with RNA and an enzyme, called reverse transcriptase, which is capable of producing DNA from an RNA template. Once the complementary DNA is produced, it becomes incorporated into the host cell’s DNA and the host cell begins to produce proteins from the viral genome.

Figure 13.2.2b – RetrovirusFigure 13.2.2b – Retrovirus
Genetic modification of plants using the TMV vector

  • The tobacco mosaic virus (TMV) is a retrovirus that infects tobacco plants and causes mottling of leaves.

Figure 13.2.2c – TMV infectionFigure 13.2.2c – TMV infection
Normal leaf (left) and infected leaf (middle) leaf; tobacco mosaic virus (right)

  • Current research is focused on the genetic manipulation of TMV to include RNA segments that will code for the production of Hepatitis B antigens.
  • The virus can then be used as a vector to modify tobacco plants for the production of human vaccines.
  • Two strategies are possible: the target proteins may be harvested (biopharming) and purified, or the plants themselves might be administered as edible vaccines.

Use of Ti plasmid for modification of soybean crops

  • Agrobacterium tumefaciens is a naturally-occurring pathogen that transfers part of its own DNA – called the Ti-plasmid – into plant cells, causing tumours in plant tissues.
  • Ti-plasmid is used as a vector in the genetic modification of soybeans, to insert genes for resistance to glyphosphate, a herbicide.

Figure 13.2.2d – Overview of transformation by t-DNA (Ti-plasmid) in crop plants

Skill: Identifying Open Reading Frames

  • Open reading frames are long genetic sequences that are uninterrupted by stop codons. Consider the DNA sequence shown below:

5’   CAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAATCCGAG  3’

3’   GTTACCGATCCATGATACATACTCTAGTACTAGAAATGTTTAGGCTC  5’

Figure 13.2.2e – DNA templateFigure 13.2.2e – DNA template

  • When the top strand is transcribed, the following mRNA sequence results:

5' CUCGGAUUUGUAAAGAUCAUGAUCUCAUACAUAGUACCUAGCCAUUG 3'

  • This mRNA molecule has three reading frames:

Reading frame 1:

CUC GGA UUU GUA AAG AUC AUG AUC UCA UAC AUA GUA CCU AGC CAU UG

Reading frame 2:

C UCG GAU UUG UAA AGA UCA UGA UCU CAU ACA UAG UAC CUA GCC AUU G

Reading frame 3:

CA AUG GCU AGG UAC UAU GUA UGA GAU CAU GAU CUU UAC AAA UCC GAG

  • Recall that AUG is the start codonUAA, UGA and UAG are stop codons.
  • Reading frame 1 contains a start codon (bold), but no stop codons.
  • Reading frame 2 contains stop codons (underlined) but no start codons.
  • Reading frame 3 contains both start and stop codons.
  • Therefore, the only possible ORF is reading frame 1.

Try it!

  • Determine whether there are open reading frames on the bottom strand of the DNA template in Figure 13.2.2e.

Figure 13.2.2f – Ti-plasmidFigure 13.2.2f – Ti-plasmid
Biotech companies take advantage of the Ti-plasmid’s natural ability to infect plant cells with foreign DNA.

Course links

Figure 13.2.2gFigure 13.2.2g

Nature of Science

Assessing risks and benefits of scientific research:

  • What are the advantages and disadvantages of edible vaccines?
  • Do they environmental benefits of herbicide resistant crops, such as decreased tillage and increased yields, outweigh the risk of contamination by herbicide resistant genes?
  • Amflora potatoes have been banned in the European Union. To what extent do political and ethical considerations limit scientific research?

Figure 13.2.2h – Roundup ReadyFigure 13.2.2h – Roundup Ready

Science and social responsibility (Aim 8)

The Monsanto corporation produces a glyphosphate herbicide under the trade name Roundup, and many glyphosphate-resistant crop seeds called Roundup Ready.  To maintain patent rights, farmers are required to repurchase seeds every year rather than save seeds and replant them.

Further reading

Read about a recent Supreme Court cases brought against farmers who deliberately replanted Monsanto patented seeds:

www.biofortified.org

Downloads

Open reading frame activity Word | PDF